Electronic Patient Scheduling System

All potential stakeholders and/or users will give input regarding which software they feel will best suit the clinic's needs. Constraints: The scheduling system must update on all department computers after any new entry has been made. The system must be operational by December 20th, 013. The system must know average appointment times for all types of visits to avoid over booking patients. The system must alert users of cancellations or changes so 3. Perform fact-finding: Analyze the organizational chart of the clinic to determine stakeholders and/or users. Interview receptionists, nurses, doctors and assistants.Review the current paper patient appointment scheduling method. Observe the clinics operations for a day. Survey receptionists, doctors, nurses and assistants on what expectations they may have for an electronic patient appointment scheduling system. Identify the costs of the new electronic system. . Study usability, cost, benefit and schedule data: Analyze the interview info rmation. Analyze the user surveys. Analyze observation notes to highlight key facts. Compare cost data. 5. Evaluate feasibility Operational Feasibility: Will the clinic users be able to effectively use the new system?Will extra training be needed for computer and software use? The IT department will work with all users through hands on training to make sure that everyone understands the new system. Technical Feasibility: Does the clinic have the necessary software, hardware, equipment and networking resources available for the new system? Does the current system need to be upgraded to handle the change effectively? Heartfelt will upgrade their current computers. Networking resources are currently in place and new software will be purchased.Economic Feasibility: Can the clinic afford the new patient appointment scheduling software? Can the clinic afford training for the users? Can the clinic afford new equipment if needed? The clinic has been diligent in staying within the allotted b udget. Training and software will be purchased once all measures have been set in place. Schedule Feasibility: Can the clinic stakeholders' timeline of December 20th, 2013 be met? . Present recommendations to management: I will prepare a written preliminary investigation report and present all of my findings to the clinic stakeholders.Some items to be included: Introduction-overview of the report; Systems Request Summary-basis of the systems request; Findings-results of preliminary investigation and Time and Cost Estimates-cost of acquiring and installing the new system and total cost of ownership during the life of the system. Systems Review: The current patient appointment scheduling system at Heartfelt Clinic is paper based. The clinic started out as a small clinic, but it is centrally located nd has since grown tremendously.

Philosophies of Education Essay

There are many different educational philosophies that have developed over the years. Some of these philosophies are teacher-centered and some are student-centered, but they all have the same goal, and the goal is to provide students with the best education possible. The following is a list of educational philosophies and their basic ideas. 1. Perennialism- is a teacher centered philosophy that focuses on the values associated with reason. It considers knowledge as enduring, seeks everlasting truths, and views principles of existence as constant or unchanging. For Perennialists, the aim of education is to ensure that students acquire understandings about the great ideas of Western civilization. These ideas have the potential for solving problems in any era. The focus is to teach ideas that are everlasting, to seek enduring truths which are constant, not changing, as the natural and human worlds at their most essential level, do not change. Teaching these unchanging principles is critical. Humans are rational beings, and their minds need to be developed. Thus, cultivation of the intellect is the highest priority in a worthwhile education. The demanding curriculum focuses on attaining cultural literacy, stressing students’ growth in enduring disciplines. 2. Essentialism- is a teacher centered philosophy that believes there is a common set of skills and knowledge that educated people should have. It focuses on respect for authority, developing sound habits of the mind, and training in fundamentals. Essentialism is similar to perrenialism. Schooling should be practical, preparing students to become valuable members of society. It should focus on facts-the objective reality out there–and â€Å"the basics†or â€Å" back to the basics,† training students to read, write, speak, and compute clearly and logically. Schools should not try to set or influence policies. Students should be taught hard work, respect for authority, and discipline. Consisting of discipline subject. Teachers are to help students keep their non-productive instincts in check, such as aggression or mindlessness. Early in the 20th century, essentialism was criticized as being too rigid to prepare students adequately for adult life. 3. Progressivism- is a student centered philosophy that believes that ideas should be tested by experimentation, and learning comes from finding answers from questions. This philosophy values the scientific method of teaching, allows individuals to have their own beliefs, and promotes the interaction of students as valuable to the learning process. (learning by doing things). Create independent thinking,self expression and activity in the learner. Progressivists believe that education should focus on the whole child, rather than on the content or the teacher. This educational philosophy stresses that students should test ideas by active experimentation. Learning is rooted in the questions of learners that arise through experiencing the world. It is active, not passive. The learner is a problem solver and thinker who make meaning through his or her individual experience in the physical and cultural context. Effective teachers provide experiences so that students can learn by doing. Curriculum content is derived from student interests and questions. The scientific method is used by progressivist educators so that students can study matter and events systematically and first hand. The emphasis is on process-how one comes to know. One of his tenets was that the school should improve the way of life of our citizens through experiencing freedom and democracy in schools. Shared decision making, planning of teachers with students, student-selected topics are all aspects. Books are tools, rather than authority. 4. Reconstructionism/Critical Theory- is another student centered philosophy that promotes world social progress, focuses on world events, controversial issues, and developing a vision for a new better world. This philosophy is associated with pragmatism and essentialism. Social reconstructionism is a philosophy that emphasizes the addressing of social questions and a quest to create a better society and worldwide democracy. Reconstructionist educators focus on a curriculum that highlights social reform as the aim of education. Critical theorists, like social reconstructionists, believe that systems must be changed to overcome oppression and improve human conditions. Paulo Freire (1921-1997) was a Brazilian whose experiences living in poverty led him to champion education and literacy as the vehicle for social change. In his view, humans must learn to resist oppression and not become its victims, nor oppress others. To do so requires dialog and critical consciousness, the development of awareness to overcome domination and oppression. Rather than â€Å"teaching as banking,† in which the educator deposits information into students’ heads, Freire saw teaching and learning as a process of inquiry in which the child must invent and reinvent the world. For social reconstructionists and critical theorists, curriculum focuses on student experience and taking social action on real problems, such as violence, hunger, international terrorism, inflation, and inequality. Strategies for dealing with controversial issues (particularly in social studies and literature), inquiry, dialogue, and multiple perspectives are the focus. Community-based learning and bringing the world into the classroom are also strategies. 5. Eclecticism- is a conceptual approach that does not hold rigidly to a single paradigm or set of assumptions, but instead draws upon multiple theories, styles, or ideas to gain complementary insights into a subject, or applies different theories in particular cases. It can be inelegant, and eclectics are sometimes criticized for lack of consistency in their thinking, but it is common in many fields of study. For example, most psychologists accept parts of behaviorism, but do not attempt to use the theory to explain all aspects of human behavior. A statistician may use frequentist techniques on one occasion and Bayesian ones on another. An example of eclecticism in economics is John Dunning’s eclectic theory of international production. 6. Existentialism – Student centered. If you are existentialist, subject matter is a personal choice. They focus on the importance of the student than the subject matter or curriculum. Man’s freedom. Man is nothing else but what he makes of himself. Such is the first principle of existentialism. ‘ ‘ †¢ Jean Paul Sartre Existentialism as an Educational Philosophy Existentialism rejects the existence of any source of objective, authoritative truth about metaphysics, epistemology, and ethics. Instead, individuals are responsible for determining for themselves what is â€Å"true† or â€Å"false,† â€Å"right† or â€Å"wrong,† â€Å"beautiful† or â€Å"ugly. † For the existentialist, there exists no universal form of human nature; each of us has the free will to develop as we see fit. In the existentialist classroom, subject matter takes second place to helping the students understand and appreciate themselves as unique individuals who accept complete responsibility for their thoughts, feelings, and actions. The teacher’s role is to help students define their own essence by exposing them to various paths they may take in life and creating an environment in which they may freely choose their own preferred way. Since feeling is not divorced from reason in decision making, the existentialist demands the education of the whole person, not just the mind. Although many existentialist educators provide some curricular structure, existentialism, more than other educational philosophies, affords students great latitude in their choice of subject matter. In an existentialist curriculum, students are given a wide variety of options from which to choose. To the extent that the staff, rather than the students, influence the curriculum, the humanities are commonly given tremendous emphasis. They are explored as a means of providing students with vicarious experiences that will help unleash their own creativity and self-expression. For example, rather than emphasizing historical events, existentialists focus upon the actions of historical individuals, each of whom provides possible models for the students’ own behavior. In contrast to the humanities, math and the natural sciences may be de-emphasized, presumably because their subject matter would be considered â€Å"cold,† â€Å"dry,† â€Å"objective,† and therefore less fruitful to self-awareness. Moreover, vocational education is regarded more as a means of teaching students about themselves and their potential than of earning a livelihood. In teaching art, existentialism encourages individual creativity and imagination more than copying and imitating established models. Existentialist methods focus on the individual. Learning is self-paced, self directed, and includes a great deal of individual contact with the teacher, who relates to each student openly and honestly. Although elements of existentialism occasionally appear in public schools, this philosophy has found wider acceptance in private schools and ill alternative public schools founded in the late 1960s and early 1970s. 7. Naturalism- ‘’Back to Nature† slogan. Naturalism emphasizes ‘Matter and Physical world. Aim to unfold the child potential. We are born weak, we need strength; helpless, we need aid; foolish, we need reason. All that we lack at birth, all that we need when we come to man’s estate, is the gift of education. ~Jean Jacques Rousseau Naturalism as a philosophy of education was developed in the 18th century. It is based on the assumption that nature represents the wholeness of reality. Nature, itself, is a total system that contains and explains all existence including human beings and human nature Education must conform to the natural processes of growth and mental development. This root principle, already touched upon, stems from a concern to understand the nature of the child and follows from naturalism’s conception of the pupil. It is the make up of the learner that determines the character of the learning process, not the designs of teachers of the learner or there simply will be no learning. Education should be pleasurable; for children have a good time when they are doing things which the present development of their physical and mental equipment makes them ready to do. This readiness for specific kinds of activity is evidenced by their interest. Consequently, interest in a subject and interest in ways of doing things are guides to parents and teachers, both as to subjects of study and methods of teaching for which children have a natural readiness at any given stage of development. Education should engage the spontaneous self-activity of the child. As already noted, the child educates himself in great measure, most of his knowledge is base on what he discovers in his own active relations with things and people. Especially is this the case with our perceptions, developed almost completely by our own unconscious efforts in early childhood but constituting the machinery for a high percentage of our adult experiences. Adults are foolish, therefore, if they do not use this native self-activity as an ally in their teaching. The way to do this, Spencer advised, is to tell the learner as little as possible and induce him to discover as much as possible. The teacher’s role is to remain in background. The natural development of child should be stimulated. Since, Nature is considered to be best educator, According to naturalists the teacher is the observer and facilitator of the child’s development rather than a giver of information, ideas, ideals and will power or a molder of character. 8. Realism – Teacher centered. Slogan,â€Å"Things rather than words†. And according to Realism the external world of objects is not imaginary. It really exists, â€Å"Our experience is not independent but determines reaction to the external objects. Experiences are influenced by the external world which has real existence. † (Dr. Pandey Ram Shakal. The teacher is more focus to the lesson rather to the child. ( That’s the reality). Subject: Math and Science. 9. Idealism- is a philosophical approach that has as its central tenet that, ideas are the only true reality, the only thing worth knowing. In a search for truth, beauty and justice that is enduring and everlasting, the focus is on conscious reasoning in the mind. The aim of education is to discover and develop each individual’s abilities and full moral excellence in order to better serve the society. Deals with â€Å"mind and self†. Developing child potential. Ex. If a child is good in reasoning encourage him/her to develop that. In idealism, no comparison only encouragement. 10. Pragmatism- â€Å"Pragmatism is a temper of mind, an attitude, it is also a theory of the nature of ideas and truth and finally it is a theory about reality. † William James â€Å". Pragmatism is essentially a humanistic philosophy, maintaining that man creates his own values in the course of activity that reality is still in the making and awaits its part of completion from the future, that to an uncertain able extent our truths are manmade products. Method of teaching: This school of philosophy favours project method and consider it active and dynamic. Through this method the child learns by his own activities and experiences. The teacher only guiding and suggesting wherever and whenever there is necessity for such help. They believe learning by doing. They oppose bookish knowledge and condemn those methods which promote knowledge which is not useful. Teacher: works as a friend and guide to the children. The teacher comes in close contact to the children to know their interest and understanding regarding the conditions of changing society. The teacher puts in front of the students problems which are interesting and students are expected to solve it. 11. Constructivism- is a student centered philosophy that emphasizes hands on learning and students actively participating in lessons. Constructivists believe that students should be able to discover lessons on their own through hands on activity because it is the most effect way of learning and is considered true learning. Von Glasersfeld describes constructivism as a â€Å"theory of knowledge with roots in philosophy, psychology and cybernetics†. In the constructivist perspective, knowledge is constructed by the individual through his interactions with his environment. Learning is an active process. Students are actively engaged and are responsible for their learning. 12. Humanism- is a student centered philosophy that focuses on enhancing ones innate goodness, rejects the idea of group-oriented education, and upholds the idea of enhancing individual development. This philosophy also believes that students should be actively involved with their education on all levels, and students should be able to make choices about what they will be learning. To live life to the fullest Humanism focused on creating people who would be ideal citizens in whatever domain their work lay and would be able to speak persuasively to encourage those around them to a moral life; thus, students pursuing humanist studies were instructed from historically important works of poetry, history, grammar and rhetoric. 13. Behaviorism – is a teacher centered philosophy that is closely related to realism. This philosophy focuses on human behavior as a reaction to external stimuli, and believes that changing the environment can change misbehavior. Educational behaviorists are more interested in managing behavior in an attempt to better educate students and maintain a classroom environment conducive to the learning of each individual student. Educational behaviorists have developed systems of rewards and punishments in order to achieve academic success. He found a very strong effect from rewards but also discovered that punishment was a less effective means for control of behavior (Pulliam & Patten ). Teachers began to rapidly accept these laws of learning, and found them to be highly useful devices for classroom instruction Watson made the following statement: Give me a dozen healthy infants, well formed, to bring them up in any way I choose and I’ll guarantee you to take any one at random and train him to become any type of specialist I might select doctor, lawyer, artist, merchant-chief, and yes, even beggar-man and thief, regardless of his talents, penchants, tendencies, abilities, vocations and race of his ancestors. Watson made it very clear that he believed that behavior could be altered, modified, and controlled by using forms of reinforcement. Reinforcement was one of Skinners most important behavioral concepts. Reinforcement is the affect of reward on a response that the strengthening produces it, to the reduction of physiological need. Often times the word reinforcement is mistakenly substituted by the word reward. It is important to realize that these two words are not the same. Rewards may or may not strengthen behavior. Robert Nye, author of The Legacy of B. F. Skinner, gives the following example to clarify this misconception: A teenager may behave contrary to his parents, wishes despite the fact that they heap rewards (a car, money, freedom, and so on) on him. This example exhibits parents who are giving rewards to their son, but they are not reinforcing his desirable behaviors. Skinners definition affirms that reinforcement does strengthen behavior, and reinforcement occurs only if what is being done has that effect. Therefore, rewards may or may not strengthen behavior. In operant conditioning there are two types of reinforcement: positive and negative. Positive reinforcement is a response strengthened by the addition of something (positive reinforcer) to the situation. A child behaving to earn parental approval is an example of the effects of positive reinforcement. The parental approval is the positive reinforcer. Behaviors can also be strengthened by negative consequences. Negative reinforcement occurs when a response is strengthened by the removal of something (negative reinforcer) from the situation. Negative reinforcement should not be confused with punishment; it does refer to a process in which behavior is strengthened. Without even realizing it, teachers condition students to do things, such as stand in a straight line or to be quiet, by giving looks and/or punishments. Teachers often use the theories behind behaviorism to drive behavior plans for emotionally disturbed students. These step-by-step plans include rewards (or punishments), which condition students to achieve specific patterns of behavior. These plans are designed so that when the student performs a desired behavior, the student is rewarded with tokens or points. The students are then able to trade these tokens or points for prizes, food, playtime, or other rewards. Critics disagree with this type of extrinsic reward; however, Skinner believed that this may be necessary when other methods do not motivate the students. Skinner also believed that since teachers are conditioning most of the time, they should learn how to do it more effectively (Ozman & Craver 213). 14. Analytic- The term â€Å"analytic philosophy† can refer to: A broad philosophical tradition[2][3] characterized by an emphasis on clarity and argument (often achieved via modern formal logic and analysis of language) and a respect for the natural sciences. The more specific set of developments of early 20th-century philosophy that were the historical antecedents of the broad sense: e. g., the work of Bertrand Russell, Ludwig Wittgenstein, G. E. Moore, Gottlob Frege, and the logical positivists. – is used to described philosophy that proceeds via analysis- broadly, by seeking to understand the composition of its subject matter (or concepts of that subject matter) out of simple (or simpler) components. 15. Positivism- is a teacher centered philosophy that rejects intuition, matters of mind, essences, and inner causes. This philosophy relies on laws of matter and motion as valid, and bases truth on provable fact. It is also known as logical positivism. 16. Scholasticism- students were encouraged to face apparent contradictions in the things they were being taught, and find a consensus between teachings that seemed to oppose each other. They were expected to use their reason and experience — in combination with knowledge that was accepted on the authority of church fathers and teachers — to make their arguments. Scholasticism attempted to reconcile Christian teachings with one another, as well as with such philosophies as Aristotelianism and Neoplatonism. –(debate). Scholasticism focused on training people who would work as theologians, lawyers or doctors, and thus used works of theology, philosophy, medicine and law as a basis for study. 17. Postmodernism- The heart of postmodernism is the view that reality cannot be known nor described objectively. This contrast to the modernist view that says reality can be understood objectively. Postmodernism seeks to correct the imbalances of modernism. It reminds us that we do not possess an unlimited potential to understand and change the world for our own purposes. Ex. Under modernism, the prevailing theory of truth was known as the correspondence theory of truth. That is, something was felt to be true in so much as it corresponds to objective reality found in the world. The correspondence theory of truth caused people to believe that scientific truth equals absolute truth. Postmodernism corrects this by denying the equivalency between scientific truth and absolute truth. All scientific conclusions are now understood to be tentative simply because no one has ever made the infinite number of observations required to learn if there are any exceptions. So, postmodernism corrects modernism by helping us to understand the limits of our reasoning ability and knowledge. But postmodernism then presses things too far. Postmodernism rejects certain ideas of history. Generally refers to a form of contemporary culture, such as art and architecture. It is a style of thought which is suspicious of classical notions of truth, reason, identity, and objectivity. According to Elkind, Postmodernism venerates language rather than thought and honors human diversity as much as it does human individuality.

Happieness and Success

Happiness to me may be different from what another person may deem as happiness and what success means to me may be different from what another person may deem as success. Happiness and success Is as different to everyone as there are different people In the world. But we all need to ask ourselves â€Å"what Is It that would truly make me happy and what do I need to do to ensure that I am successful? † This is a personal responsibility question that we all need to ask of ourselves at one point in our lives.Herman Cain puts it best saying â€Å"Success is not the key to happiness. Happiness is the key to success. If you love what you are doing, you will be successful. † As a young child and as an only child growing up in Southern California while raised by a single mother I learned a lot and came to realize a few things throughout the years. Out of everything I learned throughout my life one of the things that impacted me the most was watching my mother wake up every day going to work doing a Job that she wasn't happy with doing.A Job she did out of personal spontaneously to me, to provide and to take care of me which I truly appreciate to this day. While watching her do this day In and day out, year In and year out I told myself that â€Å"l do not want to be like that when I get older, I want to be happy with the job that I am doing, no matter what it is, as long as I am happy doing it. † To me being happy with your job is the real measure of success. Alexander Jarful states in his article that, â€Å"you should start by liking what you do.The single most efficient way to increase your productivity is to be happy at work. No system, tool or methodology in the world can beat the productivity boost you get from really, really enjoying your work†. As it was my mother's personal responsibility to take care of me, it's my personal responsibility to be happy and succeed in everything that I do. Now this hasn't always been the case for me while growing up but as I have gotten older and gained more responsibility the more I strive to apply what I have learned to make It happen and apply what I have learned In my dally life.Alexander Jarful gives a list of the 10 most Important reasons why happiness tit your work is the number one productivity booster and these are his 10 reasons:† nappy people work netter wilt toners, nappy people are more creative, nappy people fix problems instead of complaining about them, happy people have more energy, happy people are more optimistic, happy people are way more motivated, happy people get sick less often, happy people learn faster, happy people worry less about making mistakes and consequently make fewer mistakes and happy people make better decisions†.Now those sound like some pretty compelling reasons on why Ewing happy is so important to have when it comes to the Job that one may have. I think it is imperative to try and be happy with work because it clearly affects one's well-being, one's health and one's relationships with friends and coworkers. How could one not be successful while being happy with work? I don't think it's possible. Happiness breeds success and the level of success one has is up to them. Just don't lose happiness as success is gained. I feel it is up to me to make it my goal to be happy with my career.To be happy ND a success later in life with my goals lay out in front of me. I need to have success in college first and try to be happy while going to school, let's face it school is not always the most fun thing to do but I can at least try to be happy doing it. By keeping in mind the end goal which the end goal is graduation so I can really start the process to doing a Job/career I can truly be happy in doing. To me being able to wake up every day being happy or to look forward to going to work would be one of the greatest things I can do in my life.By me being happy in what I'm doing will trickle own to every aspect of my life; from my business, to my family and being successful and making money will all stem from the happiness in my life and career. I want my son to look at me one day and say to his-self â€Å"l want to be like my dad when I grow up. I want to be happy with work and life Just like him. † I want for him to learn from my mistakes as I learned from my mother's mistakes. I also want him to learn from the right decisions that I made in my life. It's my personal responsibility to be successful for myself my family and to be happy while doing it.

Communication and successful management Research Paper

Communication and successful management - Research Paper Example †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦ 11 References †¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦Ã¢â‚¬ ¦.. 12 Introduction Communication is the process of passing information from one person to another with an aim of receiving feedback or response. Basically, the aim of communication is to improve good relation among people. On the other hand, management is the art of controlling, organizing and planning among others. Similarly, the main aim of management is efficiency improvement in operation. Generally, communication is a vital tool for effective management. There are different forms of communication that are vertical, horizontal, verbal, non-verbal, direct and indirect. Therefore, communication is important for successful management. Considering the importance of communication in achievement of success in management, there is need to study communication and its important contribution in successful management. Generally, the paper is a research proposal on importance of good communication to workers, employees and managers in an organizational setting. It also focuses on the creation of productive, creative and cooperative work place through good connection between employees and managers created through good communication. Significance of the study This research study basically focuses on communication and management. It tries to find out the importance of communication for effective and successful management. There has been a rising concern over relation between managers and employees. This is basically influenced by communication between them. Therefore, the study is important because it tries to establish ways of improving ways of fostering good communication between employees and managers. The study is important to organizations, employees and managers i n different sectors in the economy. If the study is successfully carried out, relation between managers and employees may be improved since effective methods may be developed. Research questions and/ or hypothesis What is communication? What is management? What are the elements of good communication? What is the importance of good communication? What are the types of communication commonly used in organizations? What is the importance of successful communication? Scope Since the research aims at determining importance of good communication for good relation among employees and managers in an organization, the data collected in this study consisted of primary data and secondary data. Each research objective therefore used varying fractions of each form of data (Babbie, and Benaquisto, 2009, p 56). The research method chosen for this study

Individual and International Response to Disasters Essay

Individual and International Response to Disasters - Essay Example The response towards major humanitarian disasters such as the deadly tsunami that struck Asia in December 2004 leaving approximately 200,000 people dead, scores of hundreds missing and property worth millions of dollars in damages has, no doubt, been massive (UN/ISDR par 4). From donations to volunteer services outpouring from all corners of the world, the responses with respect to the 21st century humanitarian crises without a sense of denial, have been commendable but not sufficient. Yet, the role of the media, an integral component of communication parameters, appears to be less than equal to the task of coercing the entire process with the right buttons; evidence points to synergies directed in the aftermath rather than in the preventive mechanisms. By definition, a disaster [according to the United Nations] refers to a sudden, adverse, disruptive event to the normal functioning of the society with intolerably widespread losses beyond the ability of the affected using the availab le resources (UN DHA/IDNDR 27). Whether man made or natural, disasters are catastrophic, instantaneous, indiscriminate in character, and more so, occur without warning thereby making adjustments efforts difficult. To be sure, man has known disasters for ages. Human suffering induced by floods and/or famines are but tales that have defied generational with deleterious damages that enjoins precious life in a long list of loses. Though helpful, the technological improvements have more than detached man from nature and made the modern era disaster occurrences even more frequent and perilous with partly irreparable consequences. Individual and international agencies/organizations respond to disasters as a show of care gesture and/or to assist in situations where facilities and resources are genuinely inadequate in addressing the humanitarian needs of the affected populations. The assistance normally ranges from immediate to long-term efforts designed to save lives of those in danger and subsequently lessen or alleviate altogether any form of suffering (â€Å"23 Principles of Humanitarian Donorship† par 3). It is worth mentioning that no single actor can successfully meet the facets of a relief/recovery without help. Indeed from the survivors’ needs spanning from health risks [nutrition and emergency shelters, for instance], to livelihood reconstructions, international disaster responses would be verily incomplete without the combinative effort from various specialized actors beginning with the affected government entities, intergovernmental organizations [the UN agencies, to be precise], nongovernmental organizations [both the domestic and the international], the Red Cross, and more importantly the support of the affected civilian populations. Nonetheless, while these actors respond uniquely in some way to humanitarian disasters, not all stretch their efforts to the ultimate objective, thus making disasters rightly multi-phased emergencies where actor s only make contributions towards a desired end. Coordinated collaboration among actors is thus vital in combining specific knowledge, skills, experiences as well as technologies. While it is almost certain that these resources will ultimately meet towards the course discussed herein, quite a number of factors [argued below] determine their supply. Factors that Influence Individual and International Response to Disasters Extreme events such as the 9/11 attacks, the 2004 Indian Ocean Tsunami, and the more recent Hurricane Sandy in the United States did produce catastrophic impacts with long-term disruption of socio-economic systems. With the exception

See word Essay Example | Topics and Well Written Essays - 500 words

See word - Essay Example Because Oprah attached her name to that project and was a highly visible face for it, some people may link the abuse to Oprah and subsequently to Harpo as a company. While the scandal passed without much damage to Oprah and her brand, it shows what could happen if a company is more famous for its powerful leader than its brand image. 2. How might Winfrey go about ensuring that Harpo survives after her departure or in the event of a loss of faith on the part of the public? Is it possible to have a true leadership succession plan in these circumstances? Winfrey can help to ensure the future success of Harpo by making both short-term and long-term plans as to the future direction of the company. This can include the issue of leadership. Potential leaders should be identified and receive training to be able to enhance their skills. Ideally, these future leaders can receive some smaller tasks to get used to how the organization functions, and over time they can be given more responsibility. At the same time, Winfrey should be decreasing her role in the organization slowly so that she can guide the future leaders before she leaves the company. If Winfrey leaves the succession plan too long, then she may be forced to leave suddenly, which would require someone else to step up to the plate. That person would likely be overwhelmed at first and the company would suffer as a result. It is possible to have a true leadership succession plan, and it is wise for powerful leaders to create one. Harpo needs to include Winfrey in this process so t hat she can impart her wisdom and knowledge to the next leader, whoever that may be. In terms of influencing the employees around her, Oprah needs to be careful not to dismiss the concerns of others. Just because she holds most of the power within the company, it does not mean that she should not be receptive to new ideas. Employees may be in awe of Oprah due to her accomplishments and

The Ethical Dilemma of Maximizing Pleasure. Utilitarianism Dilemma Essay

The Ethical Dilemma of Maximizing Pleasure. Utilitarianism Dilemma - Essay Example My predicament provides quite a simplified and inaccurate version of John Stuart Mill’s principle of utility which states that actions promoting happiness or pleasure are considered to be correct whereas actions promoting unhappiness or pain are considered to be wrong (John Stuart Mill 330). According to Mill’s principle, my choice of going to Nuit Blanche instead of studying was the right one as I was able to maximize my pleasure. But, this situation is too simplistic and does not provide a moral argument for Mill’s principle. Let us consider the following thought experiment where a trolley is out of control and it is approaching five people who cannot escape the impact. Fortunately, you are next to a switch which could change the path of the train and save the five people. But, the other track is under construction and if you were to flip the switch, you would kill one construction worker. In this situation, Mill’s principle of utility would argue that s aving five people would result in maximizing the most happiness or pleasure and therefore it would be morally justified to kill the construction worker. Thus, the central idea of Mill’s principle states that the morality of an action is contingent upon its consequence. I believe that Mill’s principle is problematic because the notion of happiness or pleasure is subjective to every human being and this subjectivity creates problems when solving ethical dilemmas. In order to present my position clearly, I will first provide the benefits of Mill’s principle. I will then elaborate on some of the common objections and problems that his principle faces and demonstrate my issue with the principle and how its application fails in contemporary society. Mill’s Principle: Mill contributed to utilitarianism through reinforcing the view that individuals ought to take actions that produce the greatest happiness among people while keeping within reason. In contrast to o ther contributors to utilitarianism, Mill was of the view that the concept of happiness had differences qualitatively i.e. being directly proportional to intelligence of the individual. He argues that happiness is superior to contentment and one who experiences higher forms of happiness would not trade them for lower forms, â€Å"Few intelligent creatures would consent to be changed into any of the lower animals for a promise of the fullest allowance of the beast’s pleasures, no intelligence would consent to be a fool† (John Stuart Mill 21). He further argues that those who have experienced only the lower happiness are not in a position to objectively contribute to the question of which one is better (23). The gist of Mill’s principle is consequentialism; that actions are right based on the degree to which the greatest good for the greatest number of people is promoted. Benefits of Mill’s Principle: Mill’s argument of utilitarianism gives a yardsti ck to judge actions as either being right or wrong on the basis of the amount of happiness caused and to how many individuals. It thus can be applied in guiding actions that potentially raise ethical questions, where it can be argued that acting for the benefit of happiness for the majority of people is the right course of action; individuals should always choose to that which produces the greatest utility. While traditional consequentialism would seem to excuse any form of action as long as it produces pleasure, Mill’s principle is based on qualitative reasoning, establishing that there are higher and lower forms of happiness, hence sadist actions such as torture cannot be excused on however much happiness they cause to majority of people. Shortfalls and Objections

Personal and professional healthcare commuinication paper Essay

Personal and professional healthcare commuinication paper - Essay Example on is relevant in health professional-patient relations, individuals’ search for, exposure to and use of health information, individuals’ adherence to clinical treatments and recommendations, the construction of public health campaigns and messages, risk communication, the education of people about how to gain access to the health care systems and the development of telehealth applications. Communication between health care professionals and patients is a requirement both for exchange of information and for content accompanying the information such as body language and facial expressions. Health care communication is the exchange or imparting of information between a health care professional and a patient so as to make the receiver understand and provide feedback and eventually act on that information (Ferrell & Coyle, 2006, pp. 542-568). Health care professionals play an important role in communicating with patients because they are always in close contact. A relationship between the health care professionals and the patient will be improved by communication and developing effective communication skills is an important factor and a priority for every health care professional. Patients are the main educational concern in basic health care education. However, this education equips health care professionals on how to contribute uniquely to promoting health in the working population. The health care professionals are usually the first point of contact with patients because of the usual direct access. When a health care professional shows that they are approachable and ready to help patients who need advice, the patients consciously make time to talk to the health care professionals. Listening is a vital tool for health care professionals, as they are usually is a common ground between management and staff when discussing the social well-being, health and quality of patients. Health care professionals may be asked questions by patients on topics that go beyond

The Importance of Analysis and Analytical Skills to the Manager Making Essay

The Importance of Analysis and Analytical Skills to the Manager Making Decisions in Business - Essay Example Specifically, the study evaluates the structured analytical approach to problems solving and discusses the concept of decision making. This is then followed by a critical analysis of three types of management decision making methods; project plan, financial modeling and diagrammatic representation. These methods are then discussed together in relation to management, before arriving at a conclusion on the study. Structured Analytical Approach to Problem Solving Management in the business world often presents with complex problems that call on managers to develop better approaches to problem solutions. Bonem (2011, p. 1-2) discusses the need for the structured analytical approach to solving problems, explaining that the aging and retiring of the baby boomer (or elderly) generation of workers takes away the invaluable experience needed in decision making. Thus, the author argues that the present managerial aspects of businesses need to adopt a structured analytical approach that will co unter the complexity of organisational problems and the lack of experiential knowledge. The structured analytical approach involves a cyclical multi-stage approach to decision making. Proctor (2010, p. 273) argues that the structured approach involves a number of discernible activities at each stage in the cycle; objective finding, fact finding, idea finding, problem finding, solution finding and acceptance finding. Cooke and Slack (1991) provide for a decentralised approach to executing the cyclic stages. This involves one or more individuals executing the component tasks of decision analysis which include administration, evaluation and implementation. The tow scholars present a normative cyclic approach consisting of 8 stages that involve recognition of the problem, objective setting, understanding the problem, determination of the options available, evaluation of the options established, selecting the most appropriate and effective option, implementation of the solution and monit oring. The structured analytical approach to problem solving as discussed above is a formidable approach to a business context as it addresses the root causes of the problem, identifies and assesses all possible strategic options and settles on the best. It also provides for monitoring, and the cyclic nature allows for awareness and readiness to face organisational problems and challenges which helps to avoid impetuous decision making. However, the approach is idealistic and requires being adapted to the specific context of the business environment (Cooke and Slack 1991). Thus, a manager should manipulate/customise it to suit the specificity in the environment and problem. The Concept of Managerial Decision Making Wang (2010, pp. 28-33) states that decision making is the process of choosing the best alternative to achieve goals in light of finite resources. The author argues that the concept of decision making cannot be divorced from resource allocation and the process of execution as these are dependent on sound decisions for success. Decision making is closely interrelated with problem solving, which Reza and Fahimi (2003, p. 2) define as the process of identifying and filling gaps on a desired and an actual organisational state. The authors relate decision making and structured problem solving, explaining that decision mak

Critically discuss the article Essay Example | Topics and Well Written Essays - 250 words

Critically discuss the article - Essay Example Just like in the investment business, the author argues that using past performance of a company’s stock is dangerous. He points out the likelihood of the stock underperforming in the future (Sullivan 2012, p. 1). According to Sullivan (2012, p. 2), investors ask the wrong question by raising an argument of the best funds between active and index funds. To the author, searching for patterns does not result to good investment policy. He proposes that the best way of picking good managers is by mixing art and science. The ability of mutual and hedge fund managers to excellently perform when the indexes are at the peak and then declining as more money comes into the funds makes the practice an art. The science of choosing managers involves a four element criteria of investment process, organizational structure, past returns and due diligence. He points out that performance track record is not the only indicator of good performance by a manager. To him, a good manager ought to have an investment plan or an institutional structure that is better than what people can see. The manager should not only use market timing, but rather understand the market properly to know when to enter and when top exit (Sullivan 2012, p. 3). The author, in trying to advice investors on the best methods to use in hiring managers who can perform has incorporated a number of factors. To him, those who use past performance make a big mistake. A number of factors can lead to managers performing well, which should be verified. However, when hiring, there is no indication that the manager is likely going to maintain the performance record or not. The author was right that a number of factors are involved in evaluating performance by a manager. The fact that the past does not always reflect the future outcome is true. However, past performance cannot be rubbished altogether. The very

Bullying Essay Example for Free

Bullying Essay Since the hands of time school bullying has been a problem in the school system, recently adding a new layer due to the advances of technology, innovations that challenge the whole infrastructure of educational purpose. Precomputers and cell phones, bullying could only be classified as physical or psychologically abuse on someone that could only be inflicted by face to face contact. Now in today technology age forms a new way of bullying without actually being in the same room or even knowing the individual. Bullying use to consist of physical beating or embarrassment like putting a kid in the garbage can but technology, created to further enhance the mind, became another distraction for the mind because bullying can be done from a distance you don’t even have to be in the same state or even know the person which makes it more difficult on the victim. Every pro has a con and in this case a major one, this method of bullying may be more traumatizing so I will compare and contrast the two types of bullying. This paper will make you decide what side is worse and will show you the comparison but after reading you should want to put a stop to bullying. First, let’s start with physical bullying because of the fact it was the first form of it. In past years, bullying consisted on the size and popularity of someone being less than the so called â€Å"cool† crowd. As time progress formed the mental aspect of bullying, which I feel is more detrimental. My mind is the actual driving for my body that controls our way of living, lower the self-esteem of an individual actually hurts more than any physical blow you could muster up. The progression of using the mental aspect of bullying became more popular because children subconsciously know what hurt more and prey on it. Cyber bulling is usually done by someone who is jealous of another and wants to embarrass them this form is mostly used in high school. Posting embarrassing pictures or videos on social network is common example this is so affective because everyone has a Facebook or twitter in today’s society so more eyes see it making it harder for the victim to overcome it. Secondly, although physical bullying is very harmful it’s also less abusive than cyber bullying because of a number of reasons; first off, with physical bullying you know of your actual bully enforcing the problem. With that information you could eventually take a stand and take of the problem yourself or ask for assistance from your guidance teacher or someone with authority. Also physical bullying and physiological bullying pretechnology didn’t in my opinion last too long. The time frame didn’t last long because before the bully usually bullied multiple people kind of taking the pressure off of you faster than just one individual. All emotions have a time limit in which time could only heal, so physical and mental wounds healed faster pretechnology than it do today. Traditional bullying has to be stopped because some kids are afraid to go to school because of the physical bullying this consist of taking lunch money, tripping or pushing in the hall or into lockers, knocking buts down to cause embarrassment even teasing people because of their weight or clothes is a form of traditional bullying and believe it or not traditional bullying affects the rates of students not graduating because they are fed up and can’t take it no more so they drop out of school. Finally, the most interesting fact of traditional bullying is why they do it. Statistics say most people who bully people have or are being bullied in their life. This interesting because if a person knows how that makes another human feel why they would force the hurt and miserable life on others. Bullies also bully because of problems at home like child abuse so they take it out on other peers. Stress can also cause people to bully because they so filled up with anger and having no one to talk to the result to bullying. Physical bullying is not only in schools it also at jobs to but no matter where you can find it at it needs to be a stop to it because it makes people miserable. Basically all traditional bullying problems are within the bully it has to do with their emotion they release on others. Physical bullying is more painful and life threating then cyber bullying and it also builds a sense a fear because they know the actual person bullying them, this can have a tremendous affect in people life because it lowers self-esteem. These are reason why traditional bullying is still affective if authorities use this to get to the bottom of bullying it can be decreased or even voided but being that our world is so advanced the bullying we should be worried about is cyber bullying which is more common because of technology. Cyber bullying has taken away some of the toughness of bullying because now you could do it from miles or even country spans away. Technology really up the antics making it more widespread than ever, with cell phones, tablets, and lap top along with the allegiance of social networking a rumor spread like a virus in its effect. A simple text became a new viral experiment that went wrong once adolescent got their hands on it. Same agenda chasing popularity and fame, but lost the ability to challenge someone face to face is one of the scariest evolvements of technology. Now you, in most cases, don’t even know who’s bullying you making it harder to pin point the problem in which it started. Cyber bullying is still a form of bullying but it’s just the mental aspect either way the victim still feels the pain. Internet bullying causes low self-esteem, emotion distress, and total embarrassment where as traditional bullying can cause emotional problems but is mostly physical pain more of the punching and physical contact end. Cyber bullying will get worse before it get better, new policies are in place but do little to change the outcome which come to the conclusion that cyber is nowhere near its peak. Internet bullying has taken away from the physical aspect but the emotional aspect of cyber bullying is far worse. Since technology is the face of the world so cyber bullying is so powerful rumors, gossips, and pictures can be uploaded on the web in seconds. There is several reports some are local about high schools uploading a naked picture of a girl on Facebook or sending to phone to phone in high school and this can lead to horrible emotions or dropping out of school do to humiliation. Even bigger all over the news a Rutgers University student committed suicide because of cyber bullying. He was secretly filmed kissing another male and his roommate puts the video on twitter with the caption â€Å"just found out my roommate is gay†. This was obviously something the student wasn’t ready to tell the world so with built up emotions he jumped off the George Washington Bridge. Clementi death bought national and international issue to cyber bullying and the struggles it’s facing. But it shouldn’t take death of a student to realize the degree of cyber bullying its pros and cons to both types of bullying I just feel cyber bullying is worse because of the generation we live in today and technology is so powerful in seconds the world can see what someone uploaded on the web. Finally, the most important fact of cyber bullying is the reason why they do it because it can be ended if we address it. These reason differ from physical bullying because it to different types of bullying. Cyber bullying comes from people who are jealous of your lifestyle and want to ruin it because their life isn’t as well as yours. Cyber bullying is also triggered by peer pressure they want to be â€Å"cool† and do what everyone else is doing but maybe if people put themselves in the victim shoes they wouldn’t do it. The most common one is from teenagers and their peers they take cyber bullying as a joke or for fun and they also think they will earn respect but who would or should respect anybody who lessens someone as a person. No matter what end of the bullying your child is on, you need to make sure that you are doing your part to prevent and stop this because bullying is a serious matter. Even though the two types of bullying have pros and cons the different types of bullying cause different types of insecurities to others but they all are tremendous and all are major and it’s up to peers, adults, and society to stop bullying. â€Å"Bullying builds character like nuclear waste creates superheroes. Its a rare occurrence and often does much more damage than endowment. †

The Main Characters of Pride and Prejudice Essay Example for Free

The Main Characters of Pride and Prejudice Essay Most people have seen the movie played by Keira Knightley and Matthew Macfadyen or read the book, pride and prejudice, wrote by Jane Austen. We may be moved by Darcy and Elizabeth’s love. Though there are full of hardships, they have a happy ending. Then I will introduce the difficult but beautiful love between them and give a analysis to this couple one aspect by one aspect. Firstly, the family backgrounds of Darcy and Elizabeth is the basic things that we should know. Darcy is a noble descent and he inherits an enormous amount o f property. It is said that â€Å"his annual income is assessed at ten thousand pounds. †? So he never worries about his own food, clothing, shelter and transportation. He dislikes making friends with common people; he is a self-willed man and he likes to dominate his close friends. But he is a fine, tall person with handsome features. However, compared with Darcy, Elizabeth’s family is really poor, though they live a better life than the ordinary people. There are five daughters in this family. Unlike other sisters, Elizabeth likes reading, and she is â€Å"the apple of her father’s eye†.? And it is the same reason that she looks things in a different way and makes her so unique. Secondly, it is the turn for me to introduce the characteristics of Darcy and Elizabeth. Different from Bingley, Darcy is not talkative in front of the strangers. He only asks the familiar women to have a dance, because he can not speak sugared words to the strange women. People who do not know about him will consider him as a pride man. Actually, pride is not his characteristic. It is the education he has received that he is superior to the people. That is the reason why he has a proud and hypercritical character. There is no doubt that the proud and hypercritical character depends on a lot of property, noble social status and strong power. Events force Darcy to modify identification of social desirability and social status.? For the reason that he is fastidious,he has only a good friend, Bingley. It is not difficult to understand he must be particular about his wife. The woman who can make him fall in love must be not only beautiful, but also special, well-educated and knowledgeable. †? Elizabeth lives in a society of stationary characters in its conditions and outlook. Generations are born, and die and are succeeded by their descents, living in the same places and doing the same things. There is so little change of ideas: democracy has not yet raised her horrid head money is a potential problem; courtship has its own drama. People around her are almost all foolish, passive and reposeful, though there are a few exceptions. Her father, Mr. Bennet is a country gentleman in whom irony is the most salient quality and who by wit, quick common sense and appreciation of character makes some amends for the selfish indifference, which is the ground of his character. † With no doubt, Elizabeth is her father’s daughter in taste and intellect, As well as in possessing a strong critical judgment, though there is indeed some likeness in her character with her mother’s warm feeling, hasty judgments are common to both; Mrs. Bennet’s feelings, impulsiveness, judgments and speeches are generally wrong, and Elizabeth’s are generally right; but there is as much likeness between mother and daughter as may exist between a lively and sensible woman and a lively fool. In a word, in her character, to a large extent, there is a mixture of her father and mother. â€Å"Capability for judgment is one of the charming, strong points of Elizabeth. †? She has more quickness of observation and is capable of both complex impressions and complex ideas. Her sensibility and intelligence rarely fail her in her reading of human minds, observing life and drawing out her correct first impression. Her first impression about Darcy’s house is accurate and authenticated and of figures like Mrs. Collins, Lady Catherine is right. However, her first impression is wrong. It is partly owing to Darcy’s own deportment, his proud manner and insulting proposals, partly to her too quick response and partly to her guilt of credulity—she puts too much confidence in Wickham’s entirely false, slanderous remarks. Human life is a complicated thing, this is one of the reasons we can find. Thirdly, I will show Darcy’s pride and Elizabeth’s prejudice clearly. Let Darcy be the first one to be introduced. One reflection of Darcys proud behavior is at the very beginning at the ball in Merton. In just a couple of hours people begin to dislike him. Mr. Darcy soon draws the attention of the room by his fine, tall person with handsome features. The gentlemen pronounced him to be a fine figure of a man till his manners gives disgust for he was discovered to be proud. The other reflection of Darcys pride is his first proposal scene. After months of struggle and consideration, Darcy chooses to open his heart to Elizabeth and tells her all his love. However, â€Å"Darcy neglects the proper words on a proposal occasion though his feeling is more of tenderness rather than pride. †? His honest confession of all his thoughts doesnt win him the pleasure of marriage; instead, it arouses the argument involving Janes happiness and Darcys responsibility in Wickhams case. When he treats his door keeper’s son, Wickham, he is also so arrogant. He says nothing or says â€Å"hello† in front of the girls at the sight of Wickham who has not seen for a long time. It is the result that he is above meeting Wickham. However, the girls may regard him insolent and rude. At the same time, when Elizabeth refers to Wickham at party, Darcy does not make any explanation. He does not speak it out the facts that Wickham is not kind because he believes that people will find it out on themselves. Of course,he will not communicate with Kerens who like to flatter. â€Å"He goes away with no word when he meets Kerens. ? Now it is the time for Elizabeth. The first time that they meet is at the party. When Bingley introduces him to Elizabeth, he only says that she is not so beautiful to attract my attention and he will not dance with other women.. he must know that Elizabeth can hear it when he is saying that. Darcy is proud enough to speak it out without care and it is easy to find out he is quite a pride man. In fact, Darcy is attracted by Elizabeth’s beautiful eyes at the first sight of her. When he answers Bingley, he has fallen in love with Elizabeth. However, he can reject Bingley’s advice in an impolite way, which is talked to her friends as a joke by Elizabeth. Then Mrs. Bennett lets her oldest daughter riding a horse to Bingley’s home in order to attract Bingley’s attention. The oldest daughter gets a cold, so she must stay at Bingley’s house for a few days. When Elizabeth visits her sister on foot, she comes across with Darcy. During those days, Darcy has realized that he loves Elizabeth. But he does things still arrogantly instead of baring his heart to her. When he extremely wants to ask Elizabeth to have a dance, he says thatâ€Å" he will give her an opportunity to have a dance with him. †? It is too rude for a woman to accept it. It is just like charity and no woman wants to dance with him after hearing that. Finally, the development of relationships between Darcy and Elizabeth will be told in details. At first, there are something unhappy between Darcy and Elizabeth. When Elizabeth visits the Kerens, Elizabeth meets Darcy’s cousin ,Colonel Fitzwilliam,she knows hat from him it is Darcy who has prevented Bingley from marrying Jane and privately hinks Jane does not lose heart to Bingley who, he thinks, could get little benefit and happiness from the bonnet. So Darcy covers up that Jane has gone to London to have a visit to Miss Bingley. But Darcy does not know that Jane is a girl who is not good at expressing her feelings. He could not imagine that his self-opinionated action has made great hurt to Bingley and Jane. It h as a vivid and incisive description of his pride in this novel when Darcy decides to propose marriage to Elizabeth; it is also the climax of the novel to describe Darcy’s character. After thinking clearly, Darcy makes an offer of marriage to Elizabeth in a special way. He says thatâ€Å" Elizabeth is born in a poor family and it is her honor to marry him. †? He thinks that Elizabeth should accept it and repay him for his precious love. He guesses that Elizabeth would love him and accept happily just as Bingley should not marry Jane. But they are all his private thoughts. She repulses his offer of marriage, which really gives a hit to Darcy’s pride. However, it is a good opportunity for Darcy to introspect what is wrong and also foreshadows their happy ending. Then Mr. Darcy helps Mr. Bingley and Jane eliminates their misunderstanding; He also solves Lydia’s scandal and rescues her and the entire Bennet family from disgrace. Finally, they have a happy ending. It is the turning point of their relationships. I have introduced Darcy and Elizabeth’s beautiful love story and also witness a couple from strangers to from a family. Their love tells us that marriage is not only based on the property and social status, but also built on the adoring each other and respecting each other.

Characterisation of Prostate Cancer Stem Cells

Characterisation of Prostate Cancer Stem Cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 20–24 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin ÃŽ ±2ÃŽ ²1. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37 °C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 ÃŽ ¼g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20 µg/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70 °C and thawed at 37 °c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600 µl of RLT Plus (10 µl of ÃŽ ²-mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700 µl of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700  µl of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500  µl of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30  µl of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80 °C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturer’s instruction 2  µl (2  µg) of previously prepared RNA was added to 1 µl of 50uM oligo (dT)20, 1 µl of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10  µl. The reaction tube was incubated at 65 °C for 5 mins and then placed on ice for one min. In another tube 2  µl of 10X RT buffer, 4 µl of 25mM Mgcl2, 2  µl of 0.1DTT, 1  µl of RNaseOUTTM (40U/  µl) and 1  µl of SuperScriptTM III RT (200 U/  µl) was added. The 10  µl mix of the first tube was added to the second tube and incubated for 50 mins at 50 °C. The reaction was terminated by incubating at 85 °C for 5mins and then chilled on ice. 1  µl of RNase H was added to the tube and incubated for 20 mins at 37 °C. The total yield of cDNA was 25  µl and this was stored at -20 °C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5  µl of 10xPCR buffer II, 3 or 6  µl of 25mM MgCl2, 4  µl of 10mM dNTP, 1  µl of forward and reverse primer at 10  µM and 0.25  µl of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/ µl was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94 °C for 6 min, and then 35 cycles of 94 °C for 30 secs, 55 °C for 30 secs, 68 °C for 30 secs, 72 °C for 30 secs followed by 72 °C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: †¢ A reporter dye (6-FAM) linked to the 5 ´ end of the probe. †¢ A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 ´ end of the probe 5 ´ Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 ´ end and a quencher dye at the 3 ´ end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan ® probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10  µl of final volume of TaqMan mix was placed. The mixture included 5 µl of TaqMan Gene Expression Assay, 0.5  µl of the primer, 0.5  µl of GAPDH (endogenous Control) and 4  µl of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50 °C for 2 min, followed by 95 °C for 10 mins. Then 40 cycles of 95 °C for 15 secs and 60 °C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/ µl versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RT—PCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/ µl for C42B and 190ng/ µl for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/  µl, 5ng/ µl, 20ng/  µl and 50ng/  µl) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient ≠¥ 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/ µl, 5  µl, 20  µl and 50  µl . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 ≠¥90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH à ¢Ã‹â€ Ã¢â‚¬  Ct à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the à ¢Ã‹â€ Ã¢â‚¬  Ct value was calculated from the standard curve. d. Relative quantification or fold changes. à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct is calculated by subtracting the à ¢Ã‹â€ Ã¢â‚¬  Ct value of the adherent cells from the à ¢Ã‹â€ Ã¢â‚¬  Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-à ¢Ã‹â€ Ã¢â‚¬  Ãƒ ¢Ã‹â€ Ã¢â‚¬  Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the ΔΔCt method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, ÃŽ ±2ÃŽ ²1 integrin, Sca-1 and ÃŽ ²-catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. ÃŽ ²-catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumour–initiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp